View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15424_high_28 (Length: 252)
Name: NF15424_high_28
Description: NF15424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15424_high_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 10 - 236
Target Start/End: Complemental strand, 9257156 - 9256933
Alignment:
| Q |
10 |
tgtcaagtgtattttacccctgattaactttgttgtaatacacctataacaaactttagttaacaagcgaatttgcgattgatggttgcaggacatgggg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
9257156 |
tgtcaagtgtattttacccctgattaactttgttgta---cacctataacaaactttatttaacaagcaaatttgtgattgatggttgcaggacatgggg |
9257060 |
T |
 |
| Q |
110 |
aatattgagcttgacaatagcattcatatggcaactttacaccttatggttgctcgtccatcttcacgaatccgtcgagaacggtattcgctacagtcga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9257059 |
aatattgagcttgacaatagcattcatatggcaactttacaccttatggttgctcgtccatcttcacgaatccgtcgagaacggtattcgctacagtcga |
9256960 |
T |
 |
| Q |
210 |
taccttcagctttgcttcgccactttc |
236 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
9256959 |
taccttcagctttgcttcgccactttc |
9256933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 92 - 182
Target Start/End: Complemental strand, 9242627 - 9242537
Alignment:
| Q |
92 |
tggttgcaggacatggggaatattgagcttgacaatagcattcatatggcaactttacaccttatggttgctcgtccatcttcacgaatcc |
182 |
Q |
| |
|
|||||||||||||||||||||| | || ||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9242627 |
tggttgcaggacatggggaataataagtttgacaatagcattcatatggcagctttataccttatggttgctcgtccatcttcacgaatcc |
9242537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University