View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15424_high_31 (Length: 245)
Name: NF15424_high_31
Description: NF15424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15424_high_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 32597907 - 32597663
Alignment:
| Q |
1 |
atcaaacattgaactatcttgcatttatgttacgtggcttttgaaatgctccaacacctttatgttgatacaaattacgtcatagaatcacctgttaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32597907 |
atcaaacattgaactatcttgcatttacgttacgtggcttttgaaatgctccaacacctttatgttgatacaaattacgtcatagaatcacctgttaaat |
32597808 |
T |
|
| Q |
101 |
tggagagatggggatagagtttttgaacagtactctacaagattttaagtactcttagcttgtagtatctttttggaatctcttgcaaaatcataatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32597807 |
tggagagatggggatagagtttttgaacagtactctacaagattttaagtactcttagcttgtagtatctttttggaatctcttgcaaaatcataatatt |
32597708 |
T |
|
| Q |
201 |
gcttt------gcaagtggtgcttatgtcatgaaatataattcat |
239 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32597707 |
gctttgcaattgcaagtggtgcttatgtcatgaaatataattcat |
32597663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University