View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15424_high_34 (Length: 224)
Name: NF15424_high_34
Description: NF15424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15424_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 17 - 106
Target Start/End: Original strand, 36825586 - 36825675
Alignment:
| Q |
17 |
cacagatatagattacaatgctattatactcaacaaggttttctactctaccacctttcatttaactaatttcttactgttgtccgtgtc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36825586 |
cacagatatagattacaatgctattatactcaacaaggttttctactctaccacctttcatttaactaatttcttactgttgtccgtgtc |
36825675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 204
Target Start/End: Original strand, 36825738 - 36825770
Alignment:
| Q |
172 |
agtaggttgcgtggaagatatattcaatgtatt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36825738 |
agtaggttgcgtggaagatatattcaatgtatt |
36825770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University