View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15424_low_19 (Length: 330)
Name: NF15424_low_19
Description: NF15424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15424_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 322
Target Start/End: Complemental strand, 52889373 - 52889055
Alignment:
| Q |
18 |
actgaaaatgtcggaaaacatagcattgaaatcggtaatagtaactcgttaa--------------agtactacnnnnnnnnnnnncaggtgttgaattt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
52889373 |
actgaaaatgtcggaaaacatagcattgaaatcggtaatagtaactcgttaattaaggtttaaacaagtactacaaaaacaaaaaacaggtgttgaattt |
52889274 |
T |
 |
| Q |
104 |
tgattgggtagatgagaaacatacattgacatcgtttcccgaagcatcggagatagggctgtcatcggcgaatggcgttcctcggtcagaccaagctttc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52889273 |
tgattgggtagatgagaaacatacattgacatcgtttcccgaagcatcggagacagggctgtcatcggcgaatggcgttcctcggtcagaccaagctttc |
52889174 |
T |
 |
| Q |
204 |
cgaacaccgtcgtaattcaatttcaacaacaatccacttttcaactttggcgattccatttctttcaattctgcattcagtctctccactgcaacaacct |
303 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52889173 |
cgaacgccgtcgtaattcaatttcaacaacaatccacttttcaactttggcgattccatttctttcaattctgcattcagtctctccactgcaacaacct |
52889074 |
T |
 |
| Q |
304 |
tcttctttttcttcatctc |
322 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
52889073 |
tcttctttttcttcttctc |
52889055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University