View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15424_low_21 (Length: 323)
Name: NF15424_low_21
Description: NF15424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15424_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 1 - 311
Target Start/End: Complemental strand, 40460196 - 40459887
Alignment:
| Q |
1 |
acatagacaaaataatgtgaaaagattgtgatccaaaacatcctaaagaccttgcccccaagtaaatgtcgatttgtttccaccactacaatggtgtagt |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40460196 |
acatagacaaaaaaatgtgaaaagattgtgatccaaaacatcctaaagaccttgcccccaagtaaatgtcgatttgtttccaccactacaatggtgtagt |
40460097 |
T |
 |
| Q |
101 |
gtcgttatagcaggcattttcagaacacatttgtattaactagcttaccattgaacaaaagtgatttattaaatttctactatgctatagtgtctctgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40460096 |
gtcgttatagcaggcattttcagaacacatttgtattaactagcttaccattgaacaaaagtgatttattaaatttctactatgctatagtgtctctgtt |
40459997 |
T |
 |
| Q |
201 |
taacaacactagtgtttcagctgttgttgatcagtctgttgtgttggaagttatcccaatgcctaggggagtgattccttttcctttcagaagtcctttc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40459996 |
taacaacactagtgtttcagctgttgttgatcagtctgttgtgttggaa-ttatcccaatgcctaggggagtgattccttttcctttcagaagtcctttc |
40459898 |
T |
 |
| Q |
301 |
ttccatgcctt |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
40459897 |
ttccatgcctt |
40459887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University