View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15424_low_27 (Length: 299)
Name: NF15424_low_27
Description: NF15424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15424_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 48963901 - 48963713
Alignment:
| Q |
1 |
attgttaaaattccaactccaatacgtatgtcttgctggttgaattagagagtgaatatgatccgcaaaattgttttggatctgatctttaaagaatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48963901 |
attgttaaaattccaactccaatacgtatgtcttgctggttgaattagagagtgaatatgatccgcaaaattgttttggatc---tctttaaagaatgaa |
48963805 |
T |
|
| Q |
101 |
taaaatgaatttcaacactactttgacaaactat-----atctgatgtgctacaaatttacaatgatgcaacaagtctcacacatattcatt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48963804 |
taaaatgaatttcaacactactttgacaaactataatgaataaaatgcgttacaaatttacaatgatgcaacaagtctcacacatattcatt |
48963713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 187 - 284
Target Start/End: Complemental strand, 48963660 - 48963563
Alignment:
| Q |
187 |
tttcaataaatctgttagcaacaagtgattcaatgtcaattattattatgtctaaatttcaatatcataaaaacgtagacatgcaattgaaaaaacat |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48963660 |
tttcaataaatctgttagcaacaagtgattcaatgtcaattattattatgtctaaatttcaatatcataaaaatgtagacatgcaattgaaaaaacat |
48963563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University