View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15424_low_30 (Length: 278)
Name: NF15424_low_30
Description: NF15424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15424_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 21 - 270
Target Start/End: Complemental strand, 39088813 - 39088564
Alignment:
| Q |
21 |
aaagcgatccacaccattccaattatcgagatcataagcggtaaagtgtttacatgaagcagccacctttaaccggctattgtcggttccctgtagtcct |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
39088813 |
aaagcgatccacaccattccaattatcgagatcataagcggtaaagtgtttacatgaagcagccacctttaaccggctactgtctgttccctgtagtcct |
39088714 |
T |
 |
| Q |
121 |
ctcacataactggcagcgtatttacctgctagaattggatcctcaccgggagtctcctgtccacgaccccatcgtgggtcccgaaaaatgttcacatttg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39088713 |
ctcacataactggcagcgtatttacctgctagaattggatcctcaccgggagtctcctgtccacgaccccatcgtgggtcccgaaaaatgttcacatttg |
39088614 |
T |
 |
| Q |
221 |
gactccaatatgtcaaccctgccgttcctccgttgtacattgcctttgct |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39088613 |
gactccaatatgtcaaccctgccgttcctccgttgtacattgcccttgct |
39088564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 82; Significance: 9e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 21 - 270
Target Start/End: Original strand, 44718112 - 44718361
Alignment:
| Q |
21 |
aaagcgatccacaccattccaattatcgagatcataagcggtaaagtgtttacatgaagcagccacctttaaccggctattgtcggttccctgtagtcct |
120 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||| || |||||||| || ||||||| ||||| ||| | || ||| ||||||||||| || |
|
|
| T |
44718112 |
aaagcgatccacaccattccaattatcaacatcataagctgtgaagtgtttgcaacaagcagctaccttcaacttgttaccgtctgttccctgtagcccc |
44718211 |
T |
 |
| Q |
121 |
ctcacataactggcagcgtatttacctgctagaattggatcctcaccgggagtctcctgtccacgaccccatcgtgggtcccgaaaaatgttcacatttg |
220 |
Q |
| |
|
| |||||||| || || ||| |||| ||||| | || || ||||||||||| ||||||||||||||||| | ||||| | |||||||||||||||| |
|
|
| T |
44718212 |
ttaacataactagcggcatatctaccggctagtacagggtcttcaccgggagtttcctgtccacgaccccacctagggtctctgaaaatgttcacatttg |
44718311 |
T |
 |
| Q |
221 |
gactccaatatgtcaaccctgccgttcctccgttgtacattgcctttgct |
270 |
Q |
| |
|
|||||||||| || |||||||| | |||||| |||||||||||| ||||| |
|
|
| T |
44718312 |
gactccaataagttaaccctgctgctcctccattgtacattgcccttgct |
44718361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 124 - 263
Target Start/End: Complemental strand, 13300547 - 13300408
Alignment:
| Q |
124 |
acataactggcagcgtatttacctgctagaattggatcctcaccgggagtctcctgtccacgaccccatcgtgggtcccgaaaaatgttcacatttggac |
223 |
Q |
| |
|
||||||||||| || ||||| || || | | | ||||| |||||||| ||||| || ||||| ||||| ||||| || || ||||| |||||||| |||| |
|
|
| T |
13300547 |
acataactggcggcatattttccggccacagtgggatcttcaccgggtgtctcttggccacggccccaccgtggatcacggaaaatattcacattaggac |
13300448 |
T |
 |
| Q |
224 |
tccaatatgtcaaccctgccgttcctccgttgtacattgc |
263 |
Q |
| |
|
||||| | ||||||||||| | ||| || ||||||||||| |
|
|
| T |
13300447 |
tccaaaaagtcaaccctgcagctccaccattgtacattgc |
13300408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 25 - 74
Target Start/End: Complemental strand, 25957420 - 25957371
Alignment:
| Q |
25 |
cgatccacaccattccaattatcgagatcataagcggtaaagtgtttaca |
74 |
Q |
| |
|
||||||||||| ||||||||||| | |||||| || |||||||||||||| |
|
|
| T |
25957420 |
cgatccacacctttccaattatccaaatcataggcagtaaagtgtttaca |
25957371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University