View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15424_low_33 (Length: 261)
Name: NF15424_low_33
Description: NF15424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15424_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 243
Target Start/End: Original strand, 43200100 - 43200327
Alignment:
| Q |
16 |
atgaaagggaggagttaaagtctcaaccttggtagcttcagcgtaattcccctttttacgagtaatcctcccaatgaagcgttcaccgggaagagcacgg |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43200100 |
atgaaaaggaggagttaaagtctcaaccttggtagcttcagcgtaattcccctttttacgagtaatcctcccaatgaagcgttcaccgggaagagcacgg |
43200199 |
T |
|
| Q |
116 |
tcacacatgactacaaaaccggtatcagtaactttgcaaagacctttgcctttgaaagcgagggattcgcagagtagttcaagggtttggccgcgtttag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43200200 |
tcacacatgactacaaaaccggtatcagtaactttgcaaagacctttgcctttgaaagcgagggattcgcagagtagttcaagggtttggccgcgtttag |
43200299 |
T |
|
| Q |
216 |
ggaaataggaagtggaggtgttagggtt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
43200300 |
ggaaataggaagtggaggtgttagggtt |
43200327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University