View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15424_low_38 (Length: 238)
Name: NF15424_low_38
Description: NF15424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15424_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 18 - 127
Target Start/End: Complemental strand, 36573161 - 36573052
Alignment:
| Q |
18 |
tttttctctggtcaagaatcaagttagttaccaataatcacgtgaaagataagtttaactaaaagaatcttggtcatagatagatttagttagttaattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36573161 |
tttttctctggtcaagaatcaagttagttaccaataatcacgtgaaagataagtttaactaaaagaatcttggtcatagatagatttagttagttaattt |
36573062 |
T |
 |
| Q |
118 |
gattaggttc |
127 |
Q |
| |
|
|||||||||| |
|
|
| T |
36573061 |
gattaggttc |
36573052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 125 - 230
Target Start/End: Original strand, 28129538 - 28129643
Alignment:
| Q |
125 |
ttcatatgagtaattagaggatgaaggttgtatttagtataaaaatcttaggtacattattagcattttattaaggaacagttaatccgtcaataccacc |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| ||||| |
|
|
| T |
28129538 |
ttcatatgagtaattagaggatgaaggttgtgtttagtataaaaatcttaggtacattattagcattttattaagcaacagttaatccaccaatgccacc |
28129637 |
T |
 |
| Q |
225 |
attagt |
230 |
Q |
| |
|
|||||| |
|
|
| T |
28129638 |
attagt |
28129643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 125 - 230
Target Start/End: Complemental strand, 44822188 - 44822083
Alignment:
| Q |
125 |
ttcatatgagtaattagaggatgaaggttgtatttagtataaaaatcttaggtacattattagcattttattaaggaacagttaatccgtcaataccacc |
224 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| | ||||||||| |||||| |||| |
|
|
| T |
44822188 |
ttcatattagtaattagaggatgaaggttgtgtttagtataaaaattttaggtacattattagcattttattaagcagcagttaatctgtcaatgccact |
44822089 |
T |
 |
| Q |
225 |
attagt |
230 |
Q |
| |
|
|||||| |
|
|
| T |
44822088 |
attagt |
44822083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University