View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15424_low_40 (Length: 224)

Name: NF15424_low_40
Description: NF15424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15424_low_40
NF15424_low_40
[»] chr1 (2 HSPs)
chr1 (17-106)||(36825586-36825675)
chr1 (172-204)||(36825738-36825770)


Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 17 - 106
Target Start/End: Original strand, 36825586 - 36825675
Alignment:
17 cacagatatagattacaatgctattatactcaacaaggttttctactctaccacctttcatttaactaatttcttactgttgtccgtgtc 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36825586 cacagatatagattacaatgctattatactcaacaaggttttctactctaccacctttcatttaactaatttcttactgttgtccgtgtc 36825675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 204
Target Start/End: Original strand, 36825738 - 36825770
Alignment:
172 agtaggttgcgtggaagatatattcaatgtatt 204  Q
    |||||||||||||||||||||||||||||||||    
36825738 agtaggttgcgtggaagatatattcaatgtatt 36825770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University