View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15426_high_10 (Length: 470)
Name: NF15426_high_10
Description: NF15426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15426_high_10 |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 3e-77; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 19 - 176
Target Start/End: Original strand, 24845581 - 24845741
Alignment:
| Q |
19 |
attttaccatctcgggtaggtctatttttcatcaactcctgttctccacatgcagagcttgtcatttgatggcaaaacatcaatcttcttaaaatggctg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24845581 |
attttaccatctcgggtaggtctatttttcatcaactcctgttctccacatgcagagcttgtcatttgatggcaaaacatcaatcttcttaaaatggctg |
24845680 |
T |
 |
| Q |
119 |
caagtgctttccaatgtgaagattttgaaagttgataataaa---tgtgtgtgtgtcaaac |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24845681 |
caagtgctttccaatgtgaagattttgaaagttgataataaattgtgtgtgtgtgtcaaac |
24845741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 340 - 384
Target Start/End: Original strand, 24845906 - 24845950
Alignment:
| Q |
340 |
aaagtttaaataaacatgaattatgtctctcgttttagactcttc |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24845906 |
aaagtttaaataaacatgaattatgtctctcgttttagactcttc |
24845950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 384
Target Start/End: Complemental strand, 38260877 - 38260833
Alignment:
| Q |
340 |
aaagtttaaataaacatgaattatgtctctcgttttagactcttc |
384 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
38260877 |
aaagtttaaataaacatgaattgtgcctctcgttttagactcttc |
38260833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 98 - 145
Target Start/End: Original strand, 33084613 - 33084660
Alignment:
| Q |
98 |
tcaatcttcttaaaatggctgcaagtgctttccaatgtgaagattttg |
145 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
33084613 |
tcaatcttcctaagatggctgcaagtgctttccaatgtaaagattttg |
33084660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 3e-18; HSPs: 11)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 98 - 157
Target Start/End: Complemental strand, 8358884 - 8358825
Alignment:
| Q |
98 |
tcaatcttcttaaaatggctgcaagtgctttccaatgtgaagattttgaaagttgataat |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
8358884 |
tcaatcttcttaaaatggctgcaagtgcttgccaatgtcgagattttgaaagttgataat |
8358825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 19 - 72
Target Start/End: Complemental strand, 8355942 - 8355889
Alignment:
| Q |
19 |
attttaccatctcgggtaggtctatttttcatcaactcctgttctccacatgca |
72 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8355942 |
attttaccatgtcgggtaggtctatttttcatcaactcctgttctccacttgca |
8355889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 75 - 157
Target Start/End: Complemental strand, 9576783 - 9576699
Alignment:
| Q |
75 |
gcttgtcatttgatggcaaaacatcaatcttctta--aaatggctgcaagtgctttccaatgtgaagattttgaaagttgataat |
157 |
Q |
| |
|
||||||||| |||||| ||||| |||||||||||| | |||||||||||||||| ||||||| |||||||||||| || ||||| |
|
|
| T |
9576783 |
gcttgtcatatgatggaaaaacttcaatcttcttaggatatggctgcaagtgcttgccaatgtcaagattttgaaacttaataat |
9576699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 98 - 152
Target Start/End: Original strand, 8417072 - 8417126
Alignment:
| Q |
98 |
tcaatcttcttaaaatggctgcaagtgctttccaatgtgaagattttgaaagttg |
152 |
Q |
| |
|
||||||||||||| ||||||||||||| || ||||||| |||||||||||||||| |
|
|
| T |
8417072 |
tcaatcttcttaagatggctgcaagtgtttgccaatgtaaagattttgaaagttg |
8417126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 75 - 124
Target Start/End: Complemental strand, 8355855 - 8355806
Alignment:
| Q |
75 |
gcttgtcatttgatggcaaaacatcaatcttcttaaaatggctgcaagtg |
124 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
8355855 |
gcttgtcatatgatggcaaaacatcaatcttcttaacatggctccaagtg |
8355806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 101 - 148
Target Start/End: Complemental strand, 8035720 - 8035673
Alignment:
| Q |
101 |
atcttcttaaaatggctgcaagtgctttccaatgtgaagattttgaaa |
148 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
8035720 |
atcttcttaaattggctgcaagtgcttgccaatgtaaagattttgaaa |
8035673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 98 - 145
Target Start/End: Complemental strand, 9138321 - 9138274
Alignment:
| Q |
98 |
tcaatcttcttaaaatggctgcaagtgctttccaatgtgaagattttg |
145 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||| ||||||||| |
|
|
| T |
9138321 |
tcaatcttcttaagatggctgcaagtgcttgccaatgtcaagattttg |
9138274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 98 - 148
Target Start/End: Original strand, 8411467 - 8411517
Alignment:
| Q |
98 |
tcaatcttcttaaaatggctgcaagtgctttccaatgtgaagattttgaaa |
148 |
Q |
| |
|
||||||||| ||| |||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
8411467 |
tcaatcttcgtaagatggctgcaagtgcttgccaatgtaaagattttgaaa |
8411517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 98 - 146
Target Start/End: Complemental strand, 8041137 - 8041089
Alignment:
| Q |
98 |
tcaatcttcttaaaatggctgcaagtgctttccaatgtgaagattttga |
146 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||| |||||||||| |
|
|
| T |
8041137 |
tcaatcttcttaagatggctgcaagtgctggccaatgtaaagattttga |
8041089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 346 - 384
Target Start/End: Complemental strand, 8354607 - 8354569
Alignment:
| Q |
346 |
taaataaacatgaattatgtctctcgttttagactcttc |
384 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8354607 |
taaataaacacaaattatgtctctcgttttagactcttc |
8354569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 98 - 148
Target Start/End: Complemental strand, 43144194 - 43144144
Alignment:
| Q |
98 |
tcaatcttcttaaaatggctgcaagtgctttccaatgtgaagattttgaaa |
148 |
Q |
| |
|
|||| |||||||| |||||||||||||||| |||| || |||||||||||| |
|
|
| T |
43144194 |
tcaaccttcttaagatggctgcaagtgcttgccaacgtaaagattttgaaa |
43144144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 380
Target Start/End: Complemental strand, 59634 - 59594
Alignment:
| Q |
340 |
aaagtttaaataaacatgaattatgtctctcgttttagact |
380 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
59634 |
aaagtttaaataaacatgaattatgcctctcgttttagact |
59594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University