View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15426_high_21 (Length: 324)
Name: NF15426_high_21
Description: NF15426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15426_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 2e-71; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 19 - 176
Target Start/End: Complemental strand, 24295468 - 24295315
Alignment:
| Q |
19 |
caatcgacctctttcaatgcaatactacaaattgtagtataatattgaattcaatctaaagaatcttgaatgtttcaatcttgaatttgaatagctttga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24295468 |
caatcgacctctttcaatgcaatactacaaattgtagtataatattgaattcaatctaaagaatcttgaatgtttcaatcttgaatttgaatagctttga |
24295369 |
T |
|
| Q |
119 |
ggttcttcgttctgcaattcaggaactgattgatactactaattataaacatggattg |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
24295368 |
ggttcttcgttctgcaattcaggaactgatgg----tactaattataaacatggattg |
24295315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 249 - 324
Target Start/End: Complemental strand, 24295241 - 24295166
Alignment:
| Q |
249 |
gagttataattttgagtaaagtagcaaatcctatttttcgatttgtgcgtgttatctttgagcgcgggtcaatgtt |
324 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24295241 |
gagttataattttgagtaaagtagcaaaccctatttttcgatttgtgcgtgttatctttgagcgtgggtcaatgtt |
24295166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 79
Target Start/End: Original strand, 19629741 - 19629770
Alignment:
| Q |
50 |
ttgtagtataatattgaattcaatctaaag |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19629741 |
ttgtagtataatattgaattcaatctaaag |
19629770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University