View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15426_high_31 (Length: 270)
Name: NF15426_high_31
Description: NF15426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15426_high_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 253
Target Start/End: Original strand, 26712881 - 26713117
Alignment:
| Q |
17 |
aaacaatatttcacttctatgttaactctatcactataaagtcgaactttaaaaccattatgagaaactgataggagttgcagcataattgttaatgtta |
116 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26712881 |
aaacaatgttttacttctatgttaactctatcactataaagtcgaactttaaaaccattatgagaaactgataggagttgcagcataattgttaatgtta |
26712980 |
T |
|
| Q |
117 |
ttatgttttacattgtatgggtaataaatatagcctactgttacaaaacaaatcccaaaagtattcaattttgtccattatttaaccaaattagattaac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26712981 |
ttatgttttacattgtatgggtaataaatatagcctaatgttacaaaacaaatcccaaaagtattcaattttgtccattatttaaccaaattagattaac |
26713080 |
T |
|
| Q |
217 |
tttttcatcaaacaagtaaacaaatctataataacac |
253 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26713081 |
attttcatcaaacaagtaaacaaatatataataacac |
26713117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University