View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15426_high_32 (Length: 263)
Name: NF15426_high_32
Description: NF15426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15426_high_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 85 - 252
Target Start/End: Complemental strand, 24294987 - 24294821
Alignment:
| Q |
85 |
ttattctaatt-gggtttacggataattgagcttttaactatagttatgagattgcaaaagaaaaaatgtgtgtttatattcctatgaggtgtgactata |
183 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |||||||||| |||||||||| |||| |
|
|
| T |
24294987 |
ttattctaatttgggtttacggataattgagcttttaactatagttatgagtatgcaaaataaaaaatgtgt--ttatattcctctgaggtgtgagtata |
24294890 |
T |
 |
| Q |
184 |
actcagttgttagggacgttgcatatatacaaaggtcggggtttggacctcagattttttgcttattca |
252 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
24294889 |
actcaattgttagggacgttgcatgtatacaaaggtcggggttcggacctcagattctttgcttattca |
24294821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 24295072 - 24295026
Alignment:
| Q |
1 |
caaatattattgatgaaagaaagtagggtaaaagatcgaagataggc |
47 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24295072 |
caaatattattgatgaaagaaggtagggtaaaagatcgaagataggc |
24295026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University