View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15426_high_38 (Length: 233)
Name: NF15426_high_38
Description: NF15426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15426_high_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 26713139 - 26713359
Alignment:
| Q |
1 |
taatggcaagatctagcatttatattgttttggtggttttcttttttgctacagcactagctaaactcaccgttaatcaacaacaacaacagtgtttgcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
26713139 |
taatggcaagatctagcatttatattgttttggtggttttcttttttgctacagcactagctaaactcaccgttaatcaacaaca------gtatttgcg |
26713232 |
T |
|
| Q |
101 |
tgattgtgcagtaaaaatgggaaaacggtgtgggacccaattttttaacaaattgttcactcataataagactacaattactagagattgttgctataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26713233 |
tgattgtgcagtaaaaatgggaaaacagtgtgggacccaattttttaacaaattgttcactcatgataagactataattactagagattgttgctataaa |
26713332 |
T |
|
| Q |
201 |
attcttcaagtgggttattcttctcac |
227 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
26713333 |
attcttcaagtgggttattcttgtcac |
26713359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 137 - 227
Target Start/End: Original strand, 26704549 - 26704639
Alignment:
| Q |
137 |
ccaattttttaacaaattgttcactcataataagactacaattactagagattgttgctataaaattcttcaagtgggttattcttctcac |
227 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||| ||||||| ||||||||||||||||||| || ||||| |||||||||||| |||| |
|
|
| T |
26704549 |
ccaattttttagcaaattgttcactcgtgataagattacaatttctagagattgttgctataaggttattcaaatgggttattcttgtcac |
26704639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 3 - 62
Target Start/End: Original strand, 26704421 - 26704480
Alignment:
| Q |
3 |
atggcaagatctagcatttatattgttttggtggttttcttttttgctacagcactagct |
62 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
26704421 |
atggcaagatctaacatttatattgttttggtggctttctttttcactacagcactagct |
26704480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 138 - 227
Target Start/End: Original strand, 15375019 - 15375108
Alignment:
| Q |
138 |
caattttttaacaaattgttcactcataataagactacaattactagagattgttgctataaaattcttcaagtgggttattcttctcac |
227 |
Q |
| |
|
||||||| || |||||| |||||||||||||||||||||||||||||||||||||| || || || |||||| |||||||||| |||| |
|
|
| T |
15375019 |
caattttatagcaaattattcactcataataagactacaattactagagattgttgttacaagatccttcaaacaggttattcttgtcac |
15375108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 70
Target Start/End: Original strand, 15374893 - 15374960
Alignment:
| Q |
3 |
atggcaagatctagcatttatattgttttggtggttttcttttttgctacagcactagctaaactcac |
70 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| || ||| ||| | ||| ||||||||| |||||| |
|
|
| T |
15374893 |
atggcaagatcaagcatttatattgttttggtggcttccttatttaccacaacactagctatactcac |
15374960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University