View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15426_low_20 (Length: 389)
Name: NF15426_low_20
Description: NF15426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15426_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 1834450 - 1834632
Alignment:
| Q |
1 |
tttcaaactgcaaacatttttacagtaattaacaacaacagttgtttgaggttgttacttgtccctcacttatggttggagccaccaatgtttatttagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1834450 |
tttcaaactgcaaacatttttacagtaattaacaacaacagttgtttgaggttgttacttgtccctcacttatggttggagtcaccaatgtttatttagt |
1834549 |
T |
|
| Q |
101 |
ttttcctcaaaataattgatatggaatgatatctctcaacatatatttttatatagacacatcagttagacattgaaattatg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1834550 |
ttttcctcaaaataattgatatggaatgatatctctcaacatatatttttatatagacacatcagttagacattgaaattatg |
1834632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 180 - 225
Target Start/End: Original strand, 1835869 - 1835914
Alignment:
| Q |
180 |
tatgatatggctaattaagtgactcaactaccgatcacttgtgtca |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1835869 |
tatgatatggctaattaagtgactcaactaccgatcacttgtgtca |
1835914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 4 - 38
Target Start/End: Complemental strand, 35505571 - 35505537
Alignment:
| Q |
4 |
caaactgcaaacatttttacagtaattaacaacaa |
38 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35505571 |
caaactgcaaacatttttacagtaattaacaacaa |
35505537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University