View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15426_low_29 (Length: 310)
Name: NF15426_low_29
Description: NF15426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15426_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 15 - 293
Target Start/End: Original strand, 12810368 - 12810648
Alignment:
| Q |
15 |
caaaggaatatgaagtttaacacgactctattaggaaaatgatgttgacgggatatatgtggaatagatgagcatttggtttaaagttttagcggcttgt |
114 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||| |||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
12810368 |
caaaggaatatgaagtttaacacggctctattaggaaaatgatgttgacgg-atacatgtgaaatagaggagcatttggtttaaagttttagcagcttgt |
12810466 |
T |
|
| Q |
115 |
tttgggaaggaatgtgaccgtgtgaaggagggaggagaacaagtttttagatggtggaaagaaatagtgggtacttgtaaagggacaagtttaggggcaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||||||| ||||||| |
|
|
| T |
12810467 |
tttgggaaggaatgtgaccgtgtgaaggagggaggagcacaagtttttagatggtggaaagaaatagtgagtacttgtaaaggaacaagtttgggggcaa |
12810566 |
T |
|
| Q |
215 |
gggt-ggatccatga--nnnnnnnnnggtatggctaaaacaatagtgtaaaaaatatttgctcaaggaaattaaaaactgtg |
293 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||| |||||| | ||| ||||||||||||||||||||| |
|
|
| T |
12810567 |
gggtgggatccatgaattttttttttggtatggctaaaacaatagtgaaaaaaaaaattgatcaaggaaattaaaaactgtg |
12810648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University