View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15426_low_33 (Length: 292)
Name: NF15426_low_33
Description: NF15426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15426_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 36 - 281
Target Start/End: Complemental strand, 49705049 - 49704802
Alignment:
| Q |
36 |
ttgtgtattgagtttgatcttcctattgcacttccaaaaagtatatggtcagatagtaatggtacattgtttatctcttttacgttatgtttgtctttct |
135 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49705049 |
ttgtgtattgagcttgatcttcctattgcacttccaaaacgtatatggtcagatagtaatggtacattgtttatctcttttacgttatgtttgtctttct |
49704950 |
T |
 |
| Q |
136 |
tcacacgtaaactttgggaaatcaaatatgtattgtatactactcgatatagtttaatatactagcccccaagtacgatttcattttcaaaagtcatgca |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49704949 |
tcacacgtaaactttgggaaatcaaatatgtattgtatactactcgatatagtttaatatactagcccccaagtacgatttcattttcaaaagtcatgca |
49704850 |
T |
 |
| Q |
236 |
aatatgcaatgc--aatctggtcttgctccaatctgcatctttttctt |
281 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
49704849 |
aatatgcaatgcaaaatctggtcttgctccaatctgcatttttttctt |
49704802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University