View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15426_low_50 (Length: 224)
Name: NF15426_low_50
Description: NF15426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15426_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 11 - 216
Target Start/End: Original strand, 27942542 - 27942747
Alignment:
| Q |
11 |
gtctcttgtgaaccacaccctcccatgtaagtattgtcttctgcgatgatggcgagccgccgaactaaattatcttcggtaggcagccgcttgcgaagaa |
110 |
Q |
| |
|
|||| ||||||||| |||||||||||| ||||||||||||| ||||||||| || ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27942542 |
gtcttttgtgaaccgcaccctcccatgcaagtattgtcttccgcgatgatgacgtgccgccgaactaaattatctttggtaggcagccgcttgcgaagaa |
27942641 |
T |
 |
| Q |
111 |
gtctcaatatgaacaacgaaccttaagaggaaggtgattgcgccaaacatcatcaagcaatccccgatcaggaggtgtgtctgttgactatgtatttctt |
210 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||| || ||||||||||||||||||||||||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
27942642 |
gtctccatatgaacaacgaaccttaagaggaacgtgcttatgccaaacatcatcaagcaatccccgatcacgaggtgtgtctactgacgttgtatttctt |
27942741 |
T |
 |
| Q |
211 |
tatatt |
216 |
Q |
| |
|
||||| |
|
|
| T |
27942742 |
catatt |
27942747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 11 - 193
Target Start/End: Original strand, 34305291 - 34305474
Alignment:
| Q |
11 |
gtctcttgtgaaccacaccctcccatgtaagtattgtcttctgcgatgatggcgagccgccgaactaaattatcttcggtaggcagccgcttgcgaagaa |
110 |
Q |
| |
|
||||| || |||||||||||||||||| ||||||||||||| |||||||| | ||||||||||||| ||||||| ||| || ||||| |||||||||| |
|
|
| T |
34305291 |
gtctcctgagaaccacaccctcccatgcaagtattgtcttccgcgatgattatgtgccgccgaactaagttatctttggtcggtagccgattgcgaagaa |
34305390 |
T |
 |
| Q |
111 |
gtctcaatatgaacaacg-aaccttaagaggaaggtgattgcgccaaacatcatcaagcaatccccgatcaggaggtgtgtctg |
193 |
Q |
| |
|
||||| |||||||| | |||||||||||||| || ||| ||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
34305391 |
gtctcctgatgaacaatgaaaccttaagaggaacttgtttgtgccaaacatcatcaagcaatccctgatcacgaggtgtgtctg |
34305474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 11 - 115
Target Start/End: Complemental strand, 5320868 - 5320764
Alignment:
| Q |
11 |
gtctcttgtgaaccacaccctcccatgtaagtattgtcttctgcgatgatggcgagccgccgaactaaattatcttcggtaggcagccgcttgcgaagaa |
110 |
Q |
| |
|
||||||| |||||| ||||| |||| | || |||||||||| ||||||||| | ||||||||||||| ||||||| |||||||||||| ||||||||| |
|
|
| T |
5320868 |
gtctcttctgaaccgcacccacccacgcaaatattgtcttccgcgatgatgatgtgccgccgaactaagttatctttggtaggcagccgactgcgaagaa |
5320769 |
T |
 |
| Q |
111 |
gtctc |
115 |
Q |
| |
|
||||| |
|
|
| T |
5320768 |
gtctc |
5320764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 115
Target Start/End: Original strand, 45836605 - 45836694
Alignment:
| Q |
26 |
caccctcccatgtaagtattgtcttctgcgatgatggcgagccgccgaactaaattatcttcggtaggcagccgcttgcgaagaagtctc |
115 |
Q |
| |
|
|||||||||| |||||||||||||||| |||| | | || |||||||||||||||||| ||| || ||||| || |||||||||||| |
|
|
| T |
45836605 |
caccctcccacacaagtattgtcttctgcaatgaggatgtgctgccgaactaaattatctttggtgggaagccgattacgaagaagtctc |
45836694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University