View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15428_high_20 (Length: 322)
Name: NF15428_high_20
Description: NF15428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15428_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-141; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 35 - 307
Target Start/End: Complemental strand, 7905036 - 7904764
Alignment:
| Q |
35 |
aaaggtatatccctctgtcaacgcaaatattgcctcgacttactttcagatgcaggcctaaccacttgtaaaccggttagtactcctcttgattatgctt |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7905036 |
aaaggtatatccctctgtcaacgcaaatattgcctcgacttactttcagatgcaggcctaaccacttgtaaatcggttagtactcctcttgattatgctt |
7904937 |
T |
 |
| Q |
135 |
gtcgtctccacattgatgatggacctccctttgatgatgttttggcttatcgccgtctcattggttgcttgttatacttgactacgactcgccctgacat |
234 |
Q |
| |
|
||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7904936 |
gtcttcttcacattgatgatggacctccctttgatgatgttttggcttatcgctgtctcattggttgcttgttatacttgactacgactcgccctgacat |
7904837 |
T |
 |
| Q |
235 |
cagttttgccacacagcaactgagtcagttcatggccaagccatccgtaaaccatcatcgcgctgctctttgt |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7904836 |
cagttttgccacacagcaactgagtcagttcatggccaagccatccgtaaaccatcatcgcactgctctttgt |
7904764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 7905038 - 7905067
Alignment:
| Q |
1 |
gaggaatgagcaacctccaagccaagaaag |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7905038 |
gaggaatgagcaacctccaagccaagaaag |
7905067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University