View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15428_high_23 (Length: 260)
Name: NF15428_high_23
Description: NF15428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15428_high_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 15 - 240
Target Start/End: Original strand, 26331229 - 26331454
Alignment:
| Q |
15 |
gagatgaatatccgaaatttccatgaccctgcaatatgtcctgtggaaatgactcctgatttccgttggcaggaagtccagtattattataaagtgaatt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26331229 |
gagatgaatatccgaaatttccatgaccctgcaatatgtcctgtggaaatgactcctgatttccgttggcaggaagtccggtattattataaagtgaatt |
26331328 |
T |
|
| Q |
115 |
tgtgaaacttgatgaattggaataacagttaaccgctgagggcctaataggggctggtatgttgctgttggtcagagaatttctgttcagattgtaacct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26331329 |
tgtgaaacttgatgaattggaataacagttaaccgctgagggcctaataggggctggtatgttgctgttggtcagagaatttctgttcagattgtaacct |
26331428 |
T |
|
| Q |
215 |
gcagaaccgcgtgcagctggtacatc |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
26331429 |
gcagaaccgcgtgcagctggtacatc |
26331454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University