View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15428_high_28 (Length: 241)
Name: NF15428_high_28
Description: NF15428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15428_high_28 |
 |  |
|
| [»] chr6 (3 HSPs) |
 |  |
|
| [»] scaffold0024 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 3e-44; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 66 - 241
Target Start/End: Original strand, 2987015 - 2987203
Alignment:
| Q |
66 |
tccaaccttgaatcgattttcgaacaacaatcacttaaaattatttagagtttccac-gacaagttgatttagtacataactcacgtttgatcttgtgaa |
164 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2987015 |
tccaaccttgaatcgaatttggaacaacaatcacttaaaattattaacagtttccattgacaagttgatttagtacataactcacgtttgatcttgtgaa |
2987114 |
T |
 |
| Q |
165 |
cttacgtcgcatgtcttccaac-------tcacaaccaaaaaagcaccacattaatta-----tttttatcatatatccctacatttat |
241 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| |||||||||| |||||| ||||||||| ||||||||| |
|
|
| T |
2987115 |
cttacgtcaagtgtcttccaactcacaagtcacaaccaaaaaagcacgacattaattattatttttttaccatatatccttacatttat |
2987203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 66 - 209
Target Start/End: Original strand, 2985959 - 2986101
Alignment:
| Q |
66 |
tccaaccttgaatcgattttcgaacaacaatcacttaaaattatttagagtttccacgacaagttgatttagtacataactcacgtttgatcttgtgaac |
165 |
Q |
| |
|
||||||||| |||| | ||| ||||||||||||| |||||||| ||||||| ||| |||| ||||||||| ||||||||| ||||||| | | ||||| |
|
|
| T |
2985959 |
tccaaccttaaatccagtttggaacaacaatcacataaaattagttagagtccccaa-acaatttgatttagaacataactctcgtttgaccctatgaac |
2986057 |
T |
 |
| Q |
166 |
ttacgtcgcatgtcttccaactcacaaccaaaaaagcaccacat |
209 |
Q |
| |
|
||||||| || ||||||||||||||||||| |||||| |||| |
|
|
| T |
2986058 |
ttacgtcaagtgccttccaactcacaaccaaacaagcacgacat |
2986101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 2986915 - 2986957
Alignment:
| Q |
18 |
aaaataagagagtgcaacacttgagtaaatggtaaattgatta |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2986915 |
aaaataagagagtgcaacacttgagtaaatggtaaatttatta |
2986957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 3340181 - 3340223
Alignment:
| Q |
18 |
aaaataagagagtgcaacacttgagtaaatggtaaattgatta |
60 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
3340181 |
aaaataagagagtgcaacacttgactaaatgataaattgatta |
3340223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 166
Target Start/End: Original strand, 3340362 - 3340396
Alignment:
| Q |
132 |
atttagtacataactcacgtttgatcttgtgaact |
166 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
3340362 |
atttagtacataactcacgtttgatcatgtgaact |
3340396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 58
Target Start/End: Complemental strand, 43244 - 43204
Alignment:
| Q |
18 |
aaaataagagagtgcaacacttgagtaaatggtaaattgat |
58 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
43244 |
aaaataagagactgcaacacttgagtaaatggtgaattgat |
43204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 66 - 153
Target Start/End: Complemental strand, 33829 - 33739
Alignment:
| Q |
66 |
tccaaccttgaatcgattttcgaacaacaatcacttaaaattatttagagtttccacgacaagttgattt----agtacataactcacgttt |
153 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||| |||||| || |||| |||| |||||||||||| |||||||||||||||||| |
|
|
| T |
33829 |
tccaaccttaaatcgattttggaacaacaatcacgtaaaatgataaagagcatcca-aacaagttgatttattaagtacataactcacgttt |
33739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 66 - 115
Target Start/End: Complemental strand, 43131 - 43082
Alignment:
| Q |
66 |
tccaaccttgaatcgattttcgaacaacaatcacttaaaattatttagag |
115 |
Q |
| |
|
||||||||| ||| |||||| ||||||||||||| |||||||||| |||| |
|
|
| T |
43131 |
tccaaccttaaattgattttggaacaacaatcacataaaattattaagag |
43082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 57
Target Start/End: Original strand, 7473110 - 7473140
Alignment:
| Q |
27 |
gagtgcaacacttgagtaaatggtaaattga |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7473110 |
gagtgcaacacttgagtaaatggtaaattga |
7473140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University