View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15428_high_29 (Length: 241)
Name: NF15428_high_29
Description: NF15428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15428_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 53282722 - 53282500
Alignment:
| Q |
1 |
tctcagtcttggaattgtccaaagagccctaaaataagtataggaacttggttagatattgaattcaacatgctagtaagcaatacatcttaaaagaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53282722 |
tctcagtcttggaattgtccaaagagccctaaaataagtataggaacttggttagatattgaattcaccatgctagtaagcaatacatcttaaaagaaaa |
53282623 |
T |
 |
| Q |
101 |
ttaacggtatggtgaaatattagaaggcaaactcaacatgaacagtaattagaggctaaaatagacaaaacaatctactacacatagacaagatgtaatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53282622 |
ttaacggtatggtgaaatattagaaggcaaactcaacatgaacagtaatgagaggctaaaatagacaaaacaatctactacacatagacaagatgtaatc |
53282523 |
T |
 |
| Q |
201 |
atgctccaggtagcagagatata |
223 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
53282522 |
atgctccagttagcagagatata |
53282500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University