View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15428_low_32 (Length: 238)
Name: NF15428_low_32
Description: NF15428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15428_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 10565983 - 10566183
Alignment:
| Q |
17 |
atatatttaccattttctatatcatgcaacttcccctttcacataaataactgtattgaaactttattagctaggaagagtgtcatgaacattaatcata |
116 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10565983 |
atatatttaccattttctatatcatgaaacttcccctttcatataaataactgtattgaaactttattagctaggaagagtgtcatgaacattaatcata |
10566082 |
T |
|
| Q |
117 |
atgagtcactttagcaaagtacaccacaaaccaatttcataccctaaaaataaaaagtacaccacgacccatgtgaatttacttatgtagaagcctattg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10566083 |
atgagtcactttagcaaagtacaccacaaaccaatttcataccctaaaaataaaaagtacaccacgacccatgtgaatttacttatgtagaagcctattg |
10566182 |
T |
|
| Q |
217 |
a |
217 |
Q |
| |
|
| |
|
|
| T |
10566183 |
a |
10566183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University