View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15429_high_6 (Length: 342)
Name: NF15429_high_6
Description: NF15429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15429_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 13 - 327
Target Start/End: Original strand, 52238587 - 52238899
Alignment:
| Q |
13 |
gagatgaatgtttatgaccaatttcaagcaagattctagaaattgcctatgaaagagacaaactttttgtaatgctaataaattgacccaaacatagtac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52238587 |
gagatgaatgtttatgaccaatttcaagcaagattctagaaattgcctatgaaagagaca--ctttttgtaatgctaataaattgacccaaacatagtac |
52238684 |
T |
|
| Q |
113 |
ctgtaaaatatcaaaaactttttctgcagtgtacttttggtctgaagtagcacccttttgctgcaacttatctggatgcagactgagtaaagctctttga |
212 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52238685 |
ctgcaaaatatcaaaaactttttctgcagtgtacttttggtctgaagtagcacccttttgctgcaacttatccggatgcagactgagtaaagctctttga |
52238784 |
T |
|
| Q |
213 |
taagatcttttaaccgcattcccttcaattatatcaacaagaggcacaggcttccagccacagtttggccaaagtacctttattcatgatggaagccatt |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52238785 |
taagatcttttaaccgcgttcccttcaattatatcaacaagaggcacaggcttccagccacagtttggccaaagtacctttattcatgatggaagccatt |
52238884 |
T |
|
| Q |
313 |
ttagaacaattttgt |
327 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52238885 |
ttagaacaattttgt |
52238899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University