View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15429_low_12 (Length: 243)
Name: NF15429_low_12
Description: NF15429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15429_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 31 - 231
Target Start/End: Complemental strand, 33930998 - 33930799
Alignment:
| Q |
31 |
atttttgattgatttacggtcgattcacatcaattaaatccctctcgttttcgggaaaaatgagttttgataatttgaagtttagttaaaatgtaagtaa |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33930998 |
atttttgattgatttacggtcgattcacatcaattaaatccctctagttttcgggaaaaatgaattttgataatttgaagtttagtcaaaatgtaagtaa |
33930899 |
T |
|
| Q |
131 |
agtcaaggcaaagattgtttcagtcggaatttgaatttggattgttctaaacgattcgttttttattaaagtttattaaacacttgaattcaaatcacta |
230 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33930898 |
agtcaaggtaaagattgtttcagtcggaatttgaacttggattgttctaaacgattcgt-ttttattaaagtttattaaacacttgaattcaaatcacta |
33930800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 33931045 - 33931010
Alignment:
| Q |
1 |
cttttatgaaagatataattaaagtcaaatattttt |
36 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33931045 |
cttttatgaaagatataattaaagttaaatattttt |
33931010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University