View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1542_high_14 (Length: 276)
Name: NF1542_high_14
Description: NF1542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1542_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 12 - 121
Target Start/End: Complemental strand, 32262268 - 32262158
Alignment:
| Q |
12 |
ataatactccttggacaatatggaaattgggcaagaaaatcatcatggagatatctggaa-aaaaggtggtaggaaagcttactgataaagaagcaattc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32262268 |
ataatactccttggacaatatggaaattgggcaagaaaatcatcatggagatatctggaaaaaaaggtggtaggaaagcttactgataaagaagcaattc |
32262169 |
T |
 |
| Q |
111 |
ttaccatacca |
121 |
Q |
| |
|
||||| ||||| |
|
|
| T |
32262168 |
ttaccttacca |
32262158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 191 - 258
Target Start/End: Complemental strand, 32262090 - 32262023
Alignment:
| Q |
191 |
ggttggatcatgcagaccattccatttgtataaggtgacaagtgaataagataaaataaagtcatcta |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32262090 |
ggttggatcatgcagaccattccatttgtataaggtgacaagtgaataagataaaataaagtcatcta |
32262023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University