View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1542_high_21 (Length: 238)
Name: NF1542_high_21
Description: NF1542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1542_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 18052902 - 18053123
Alignment:
| Q |
1 |
ttatagaagaagctacagggtttctcccaggaatggaatgtaatagagattcagcaggtaacgatcaggttttaaaagtttacatgtgcgtggatatttc |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18052902 |
ttatagaagacgctacagggtttctcccaggaatggaatgtaatagagattcagcaggtaacgatcaggttttaaaagtttacatgtgcgtggatatttc |
18053001 |
T |
 |
| Q |
101 |
tgggtcaaatttcattcagtgccctaatctggtggacaactgtggtgccaaagtacaattccccaagttttaagcagaacatggtttactttgtattttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18053002 |
tgggtcaaatttcattcagtgccctagtctggtggacaactgtggtgccaaagtacaattccccaagttttaagcagaacatggtttactttgtattttg |
18053101 |
T |
 |
| Q |
201 |
attttatagttactgttatatt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
18053102 |
attttatagttactgttatatt |
18053123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 10 - 125
Target Start/End: Original strand, 18048000 - 18048115
Alignment:
| Q |
10 |
aagctacagggtttctcccaggaatggaatgtaatagagattcagcaggtaacgatcaggttttaaaagtttacatgtgcgtggatatttctgggtcaaa |
109 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||| ||| | ||| |||| ||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
18048000 |
aagctacagggtttctcccaggaatagtatgtaatagagatccaggacttaaaagtcagcttttaaaagtttacatgtgtgtggatacttctgggtcaaa |
18048099 |
T |
 |
| Q |
110 |
tttcattcagtgccct |
125 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
18048100 |
tttcattgagtgccct |
18048115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 26 - 121
Target Start/End: Original strand, 18029670 - 18029765
Alignment:
| Q |
26 |
cccaggaatggaatgtaatagagattcagcaggtaacgatcaggttttaaaagtttacatgtgcgtggatatttctgggtcaaatttcattcagtg |
121 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| || ||| ||||||||||||| ||||| | ||||||||||||||||||| |||| |
|
|
| T |
18029670 |
cccaggaatagaatgtaatagagattcagcacgtaacagccaactttatcaagtttacatgtgtgtggacacttctgggtcaaatttcattgagtg |
18029765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 27 - 125
Target Start/End: Original strand, 18035694 - 18035792
Alignment:
| Q |
27 |
ccaggaatggaatgtaatagagattcagcaggtaacgatcaggttttaaaagtttacatgtgcgtggatatttctgggtcaaatttcattcagtgccct |
125 |
Q |
| |
|
|||||||| || |||||||||||||||||| | ||| ||| ||| ||||||||||||| | ||| |||||||||||||| |||||| |||||||| |
|
|
| T |
18035694 |
ccaggaatagagtgtaatagagattcagcacgaaacagccagctttatcaagtttacatgtgtgcggacatttctgggtcaaaattcattgagtgccct |
18035792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University