View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1542_high_24 (Length: 213)
Name: NF1542_high_24
Description: NF1542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1542_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 15 - 199
Target Start/End: Complemental strand, 26490924 - 26490748
Alignment:
| Q |
15 |
aaaatatccagtacatagtgaaattcgatgacaaataaccataggggctatgccatgaacttgagtcttgcacaattctattagaagtgcctagaacctt |
114 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26490924 |
aaaatatctagtacatagtgaaattcgatgacaaataaccataggggctatgccatgaacttgagtcttgcataattctattagaagtgcctagaacctt |
26490825 |
T |
 |
| Q |
115 |
ttgtctgattatttagatacgcagtttaattctatttggagcaacatttgaaagattaagatgctagtacgaattcgatcctttg |
199 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26490824 |
ttgtctggttatttaga--------ttaattctatttggagcaacatatgaaagattaagatgctagtacgaattagatcctttg |
26490748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University