View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1542_high_3 (Length: 388)
Name: NF1542_high_3
Description: NF1542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1542_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 19 - 371
Target Start/End: Original strand, 12251668 - 12252022
Alignment:
| Q |
19 |
accacaagccgcatgagaatccactagag--ttaccagggtttaccttaatccaataagcatttagaggttttcaaacaacggtttctatattagtgtaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12251668 |
accacaagccgcatgagaatccactagagagttacgagggtttaccttaatccaataagcatttagaggttttcaaacaacggtttctatattagtgtaa |
12251767 |
T |
 |
| Q |
117 |
tgtttatagcatagcgatacaaggaaaatggcaattagaagaatcatccgtcatggccattgctgtagaaattttagctttcgctgcatgtaaagagatt |
216 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12251768 |
tgtttatagcatagggataaaaggaaaatggcaattagaagaatcatccgtcatggccattgctgtagaaattttagctttcgctgcatgtaaagagatt |
12251867 |
T |
 |
| Q |
217 |
ttggcatcgttgaactgcacaaaattccacaccatccacggcagtagagaatgctccattgtgatggtaactatttccgatacgacggcgatgagtgttc |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
12251868 |
ttggcatcgttgaactgcacaaaattccacagcatccacggcagtagagaatgcttcattgtgatggtaactatttccgacacgacggcgatgagtcttc |
12251967 |
T |
 |
| Q |
317 |
gcaatgggccggataaaagg----tgcaggcatgttagcactctgaccctcaagtcagt |
371 |
Q |
| |
|
||||| ||| |||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12251968 |
gcaat----aggacaaaaggtgcatgcaggcatgttagcactctgacactcaagtcagt |
12252022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University