View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1542_low_17 (Length: 265)

Name: NF1542_low_17
Description: NF1542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1542_low_17
NF1542_low_17
[»] chr4 (1 HSPs)
chr4 (1-256)||(30810143-30810398)


Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 30810398 - 30810143
Alignment:
1 gaatcaaacaaaaggatgaaatcaaagaaattcaaaaccctaactagcgaagaacgaatcaagagagaaagaagaagattcggttagggtttcgaaacac 100  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30810398 gaatcaaacaaaagaatgaaatcaaagaaattcaaaaccctaactagcgaagaacgaatcaagagagaaagaagaagattcggttagggtttcgaaacac 30810299  T
101 gatttacctttgggttccgatcaaatctaactttctcttgtagaaattgtgaagtttctctctattgaatctacacaggtgtacgacaacggtgggttcg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30810298 gatttacctttgggttccgatcaaatctaactttctcttgtagaaattgtgaagtttctctctattgaatctacacaggtgtacgacaacggtgggttcg 30810199  T
201 tgagcgatcgtggacttagttacacatttgggggttgcgtaactcagaagtattat 256  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30810198 tgagcgatcgtggacttagttacacatttgggggttgcgtaactcagaagtattat 30810143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University