View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1542_low_27 (Length: 226)
Name: NF1542_low_27
Description: NF1542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1542_low_27 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 33885350 - 33885125
Alignment:
| Q |
1 |
ctaaacatgttcttcctctcatacaaactttctgaaacaccatcatcttcatcattcatcaccatcttcttctgtatctcccatttagagcaacaacaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33885350 |
ctaaacatgttcttcctctcatacaaactttctgaaacaccatcatcttcatcattcatcaccatcttcttctgtctctcccatttagagcaacaacaag |
33885251 |
T |
|
| Q |
101 |
aagaggccaccccatcaatgcgttcatcaaggtatctatagataacacataaaacagcatcaagaagatcaaagttgaggaaaacattgtaaaatattat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||| |
|
|
| T |
33885250 |
aagaggccaccccatcaatgcgttcatcaaggtatctatagataacacataaaacagcatcaagaagatcaaagatgaggaaaacaatgtaacatattat |
33885151 |
T |
|
| Q |
201 |
tgagttgaacactttaatgcaattgt |
226 |
Q |
| |
|
||||||||||||| |||| ||||||| |
|
|
| T |
33885150 |
tgagttgaacactctaatacaattgt |
33885125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University