View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15430_low_13 (Length: 361)
Name: NF15430_low_13
Description: NF15430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15430_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 4e-57; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 10 - 134
Target Start/End: Original strand, 36146373 - 36146497
Alignment:
| Q |
10 |
gcagagatggagcattttgttgggttttgtcaatgggcctgttaaaataaacttcttgacccacttttatatttcatttcctttagatgattgcttaata |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36146373 |
gcagagatggagcattttgttgggttttgtcaatgggcctattaaaataaacttcttgacccactttttaatttcatttcctttagatgattgcttaata |
36146472 |
T |
|
| Q |
110 |
cacactcaaaattgatcatttgagg |
134 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
36146473 |
cacactcaaaattgatcatttgagg |
36146497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 266 - 338
Target Start/End: Original strand, 36146656 - 36146728
Alignment:
| Q |
266 |
ttgatcactaattagttcgtattgaaagaattctatttgaaaggattagtttatgcagtggtcaaaatatgcc |
338 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36146656 |
ttgatcgctaattagttcgtattgaaagaattctatttgaaaggattagtttatgcagtggtcgaaatatgcc |
36146728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 202 - 271
Target Start/End: Original strand, 36146564 - 36146633
Alignment:
| Q |
202 |
cactactagaaacttaacaatattttcaagcaccagtttagtgtagtataagttatcagatattttgatc |
271 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36146564 |
cactactagacacttaacaatattttcaagcaccagtttagtgtagtataagttatcagatatttggatc |
36146633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University