View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15430_low_14 (Length: 355)
Name: NF15430_low_14
Description: NF15430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15430_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 37975321 - 37975497
Alignment:
| Q |
1 |
aagaaactgaatcaaaatcaacaaaatgggtcgatgaatatggtgcaaaatgatcatgtgcatcattatgatgatgtagtgaattcaggttatggtcatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37975321 |
aagaaactgaatcaaaatcaacaaaatgggtcgatgactatggtgcaaaatgatcatgtgcatcatcatgatgatgtagtgaattcaggttatggtcatg |
37975420 |
T |
 |
| Q |
101 |
gtggtggttttgtcgatcagtactcaaatttaaatgggacaacttctagaaatgatgccgcagtttcttatttctca |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37975421 |
gtggtggttttgtcgatcagtactcaaatttaaatgggacaacttctagaaatgatgccgcagtttcttatttctca |
37975497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 257 - 338
Target Start/End: Original strand, 37975629 - 37975710
Alignment:
| Q |
257 |
taggaactgtaaaatcatgatcgtcaggttctatgattaatgtggtagggctcacatatgtaataagggtgtggtcattatt |
338 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37975629 |
taggaactctaaaatcatgatcgtcaggttctatgattaatgtggtagggctcacatatgtaataagggtgtggtcattatt |
37975710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University