View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15430_low_15 (Length: 326)
Name: NF15430_low_15
Description: NF15430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15430_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 8e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 16 - 119
Target Start/End: Complemental strand, 48441833 - 48441730
Alignment:
| Q |
16 |
cataggatattggtggggatgtgcatgatttgtttgatgatggtggtagtgatcgacttcttgaattgaaagaattgtctcttgatgaattagacatata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48441833 |
cataggatattggtggggatgtgcatgatttgtttgatgatggtggtagtgatcgacttcttgaattgaaagaattgtctcttgatgaattagacatata |
48441734 |
T |
|
| Q |
116 |
agct |
119 |
Q |
| |
|
|||| |
|
|
| T |
48441733 |
agct |
48441730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 69 - 169
Target Start/End: Complemental strand, 2403369 - 2403269
Alignment:
| Q |
69 |
cgacttcttgaattgaaagaattgtctcttgatgaattagacatataagctatgcttttccggatgatgagaacagggaaatgaagatgatacaactagt |
168 |
Q |
| |
|
||||||||||||||| |||| |||||| ||| ||||||||||||| ||||||| ||||| |||||||||||| || || ||||| || |||||| |||| |
|
|
| T |
2403369 |
cgacttcttgaattggaagagttgtctgttggtgaattagacatagaagctatacttttttggatgatgagaatagagagatgaaaataatacaattagt |
2403270 |
T |
|
| Q |
169 |
a |
169 |
Q |
| |
|
| |
|
|
| T |
2403269 |
a |
2403269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 52 - 104
Target Start/End: Complemental strand, 34126703 - 34126651
Alignment:
| Q |
52 |
atgatggtggtagtgatcgacttcttgaattgaaagaattgtctcttgatgaa |
104 |
Q |
| |
|
|||||| |||| |||| ||||||||||||||||||| |||||||||| |||| |
|
|
| T |
34126703 |
atgatgatggtggtgagagacttcttgaattgaaagatttgtctcttggtgaa |
34126651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University