View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15430_low_18 (Length: 227)
Name: NF15430_low_18
Description: NF15430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15430_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 79 - 212
Target Start/End: Complemental strand, 8354317 - 8354184
Alignment:
| Q |
79 |
atactattggcaattaattaataaatcaaatacacatgggttacctgcaattgctctggattagtgctgattatgaaatcatcagctcccaaacgttcct |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8354317 |
atactattggcaattaattaataaatcaaatacacatgggttacctgcaattggtctggattagtgctgattatgaaatcatcagctcccaaacgttcct |
8354218 |
T |
|
| Q |
179 |
tagcctcagcttgtttggaaggagaagtacttat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8354217 |
tagcctcagcttgtttggaaggagaagtacttat |
8354184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University