View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15430_low_19 (Length: 223)
Name: NF15430_low_19
Description: NF15430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15430_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 33066904 - 33066704
Alignment:
| Q |
18 |
gaaaaactgaaccctcctcgaaactccatttcgatcacgaacaaaatcaccat---------tttcttcttcaatcaccttagatccaatccacccttta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| | |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33066904 |
gaaaaactgaaccctcctcgaaactccatttccatcaccatcaaaatcaccataaccaccattttcttcttcaatcaccttagatccaatccacccttta |
33066805 |
T |
|
| Q |
109 |
tcattcacttttctattcactttcttacccaaaaaagagctattataaccaccagatattctacttgaagaagaagctcttgaatggtgaccataagatt |
208 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33066804 |
tcattcacttttctattcacttttctacctaaaaaggagctattataaccaccagagattctacttgaagaagaagctcttgaatggtgaccataggatt |
33066705 |
T |
|
| Q |
209 |
g |
209 |
Q |
| |
|
| |
|
|
| T |
33066704 |
g |
33066704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University