View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15431_low_13 (Length: 443)
Name: NF15431_low_13
Description: NF15431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15431_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 3e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 3e-83
Query Start/End: Original strand, 119 - 301
Target Start/End: Original strand, 4962310 - 4962496
Alignment:
| Q |
119 |
agtagtttatgattggg---aagatacatagagaacatggcctcaacacgtgtattaaatggtgccaacaacgtgtaacagtgtattgcatctgcaagta |
215 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4962310 |
agtagtttatgattggggggaagatacatagagaacatggcctcaacacgtgtattaaatggtgccaacaacgtgtaacggtgtattgcatctgcaagta |
4962409 |
T |
|
| Q |
216 |
aacaattgaagtcggtttgaaattttcaaatgcaaccaactcctactcttt-gggtctcctcacatctttgaatgggacgtggttat |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4962410 |
aacaattgaagtcggtttgaaattttcaaatgcaaccaactcctactctttggggtctcctcacatctttgaatggggcgtggttat |
4962496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 9 - 67
Target Start/End: Original strand, 4962203 - 4962261
Alignment:
| Q |
9 |
gagatgaatgaattttgaaccgttttgacaacgcagcacgtgcttatgatctccaatct |
67 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4962203 |
gagatgaatgaattttgaaccattttgacaacgcagcacgtgcttatgatctccaatct |
4962261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University