View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15431_low_25 (Length: 342)
Name: NF15431_low_25
Description: NF15431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15431_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 6e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 16 - 154
Target Start/End: Original strand, 11093616 - 11093752
Alignment:
| Q |
16 |
atgtgttggtgtcgtgtcggtgtcaatcaccgacacatatcggacaaatcctaaacccagatataaagaaagaaaataactcagttcacacaaccatttc |
115 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11093616 |
atgtgttggtgtcgtgtcaatgtcaatcaccgacacatatcggacaaatcctt--cccagatataaagaaagaaaataactcagttcacacaaccatttc |
11093713 |
T |
|
| Q |
116 |
agatcatgaaatgcaagctccacaattgaaaacaggtag |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11093714 |
agatcatgaaatgcaagctccacaattgaaaacaggtag |
11093752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 226 - 291
Target Start/End: Original strand, 11093825 - 11093890
Alignment:
| Q |
226 |
ttcacctgtttttgattaagttcaacactattatatcatcatcacgggtgagtactgagtagagta |
291 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11093825 |
ttcacctgtttttgattaagtttaacactattatatcatcatcacgggtgagtactgagtagagta |
11093890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University