View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15431_low_36 (Length: 260)
Name: NF15431_low_36
Description: NF15431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15431_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 108 - 250
Target Start/End: Original strand, 48960713 - 48960855
Alignment:
| Q |
108 |
gccctactatgtctctacccacatttaggactgcttcagcacccccatcacctcataatcagactcaacctcaagaaaagaaaacagaacaaacattttc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48960713 |
gccctactatgtctctacccacatttaggactgcttcagcacccccatcacctcataatcaaactcaacctcaagaaaagaaaacagaacaaacactttc |
48960812 |
T |
 |
| Q |
208 |
atctccacctcataggggcttgtttcctaattcttcttcatct |
250 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48960813 |
atctccacctcataggggcttgtttcccaattcttcttcatct |
48960855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University