View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15431_low_38 (Length: 252)
Name: NF15431_low_38
Description: NF15431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15431_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 29 - 241
Target Start/End: Complemental strand, 4117990 - 4117778
Alignment:
| Q |
29 |
actacttcatctatattcagttctggcatttttccaaagcattagggttccaatgaaatgtgttattactatctataaattacattattcccttgctctt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4117990 |
actacttcatctatattcagttctggcatgtttccaaagcattagggttccaatgaaatgtgttattactatctataaattacattattcccttgctctt |
4117891 |
T |
 |
| Q |
129 |
gcttgcctcattcatcacccctgcgaagtgatggctcaccacagcatccagtatcctaccattgtttaactggtactcatcttctctctcattgatgcgc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4117890 |
gcttgcctcattcatcacccctgcgaagtgatggctcaccacagcatccagtatcctaccattgtttaactgttactcatcttctctctcattgatgcgc |
4117791 |
T |
 |
| Q |
229 |
tctttcttctctc |
241 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4117790 |
tctttcttctctc |
4117778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 29 - 241
Target Start/End: Complemental strand, 21157295 - 21157083
Alignment:
| Q |
29 |
actacttcatctatattcagttctggcatttttccaaagcattagggttccaatgaaatgtgttattactatctataaattacattattcccttgctctt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21157295 |
actacttcatctatattcagttctggcatgtttccaaagcattagggttccaatgaaatgtgttattactatctataaattacattattcccttgctctt |
21157196 |
T |
 |
| Q |
129 |
gcttgcctcattcatcacccctgcgaagtgatggctcaccacagcatccagtatcctaccattgtttaactggtactcatcttctctctcattgatgcgc |
228 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21157195 |
gcttgcctcattcatcacccctgtgaagtgatggctcatcacagcatccagtatcctaccattgtttaactggtactcatcttctctctcattgatgcgc |
21157096 |
T |
 |
| Q |
229 |
tctttcttctctc |
241 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
21157095 |
tatttcttctctc |
21157083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University