View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15431_low_42 (Length: 234)

Name: NF15431_low_42
Description: NF15431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15431_low_42
NF15431_low_42
[»] chr4 (1 HSPs)
chr4 (18-180)||(42428005-42428168)


Alignment Details
Target: chr4 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 18 - 180
Target Start/End: Original strand, 42428005 - 42428168
Alignment:
18 gttactgtgaatttctttcaatttgaattttctttgtttgtagctgtttaaattgttcttggttgcacgatatacaagtaatacacnnnnnnnactcttt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||       |||||||    
42428005 gttactgtgaatttctttcaatttgaattttctttgtttgtagctgtctaaattgttcttggttgcacgatatacaagtaattcactttttttactcttt 42428104  T
118 gttaccttgaaaaacacatgacaaacaa-tttagatgtggtaaaatttgggacctggatcgtct 180  Q
    ||| |||||||||||||||||||||||| |||||||||||||||||||||||||  ||||||||    
42428105 gttgccttgaaaaacacatgacaaacaactttagatgtggtaaaatttgggaccgagatcgtct 42428168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University