View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15431_low_44 (Length: 221)
Name: NF15431_low_44
Description: NF15431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15431_low_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 21 - 207
Target Start/End: Original strand, 4576119 - 4576305
Alignment:
| Q |
21 |
ctcgaaccttcgccgcactcgaaaatcgttattggttttgattgtgaagctgttgacttgtgtcgcgatggagctctttgcataatccaggttagtgaat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4576119 |
ctcgaaccttcgccgcactcgaaaatcgttattggttttgattgtgaagctgttgacttgtgtcgcgatggagctctttgcataatccaggttagtgaat |
4576218 |
T |
|
| Q |
121 |
ttaacnnnnnnnnnnnngtgctttacgtattctaattcatatatgaagtgtttgaaactgtgttctcattattctgaaatttctgtg |
207 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4576219 |
ttaactttttcttttttgtgctttacgtattctaattcatatatgaagtgtttgaaactgtgttctcattattctgaaatttctgtg |
4576305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University