View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15432_low_3 (Length: 249)
Name: NF15432_low_3
Description: NF15432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15432_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 56401561 - 56401796
Alignment:
| Q |
1 |
aaaaaatatctatttattcttctcgctcggattgagtgtttatctttcaagtaactttagtttcaaatatccttcatttgctcgtcgttatatgaggttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56401561 |
aaaaaatatctatttattcttctcgctctgattgagtgtttatctttcaagtaactttagtttcaaatatccttcatttgctcgtcgttatatgaggttg |
56401660 |
T |
|
| Q |
101 |
ttaggagaaaatgggttgcacctgaaatagtatattttaatatttttgtgtttgttgtgtaaagaaattcaagtttatagcattctcaagagatgtggca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56401661 |
ttaggagaaaatgggttgcacctgaaatagtatattttaatatttttgtgtttgttgtgtaaagaaattcaagtttatagcattctcaagagatgtggca |
56401760 |
T |
|
| Q |
201 |
ttagttgattttattgaatttgggtcctctttacct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
56401761 |
ttagttgattttattgaatttgggtcctctttacct |
56401796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University