View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15434_high_23 (Length: 278)
Name: NF15434_high_23
Description: NF15434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15434_high_23 |
 |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 8585918 - 8585653
Alignment:
| Q |
1 |
gtgtccgaatttaacattctccccttctgaaacatggagcagttacacatcacttgtgaaattggagttatggaatagttgtcaaggacttactgccttc |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8585918 |
gtgttcgaatttaacattctccccttctgaaacatggagcagttacacatcacttgtgaaattggagttatggaatagttgtcaaggacttaccgccttc |
8585819 |
T |
 |
| Q |
101 |
tcattggatggtttccctgcgctccaaagtattcacatttatggttgtcggagtctagagtccannnnnnnatatgaacgttctctcgctcgctcctcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
8585818 |
tcattggatggtttccctgcgctccaaagtattcacatttatggctgtcggagtctagagtccatttttttatatgaacgttctctccctcgctcctcaa |
8585719 |
T |
 |
| Q |
201 |
ccatccaatgactttcaatcagtcgttgtaaggcactgcctcaacagatggacaccctctctgctc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8585718 |
ccatccaatgactttcaatcagtcgttgtaaggcactgcctcaacagatggacaccctcactgctc |
8585653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 28 - 127
Target Start/End: Original strand, 13163358 - 13163457
Alignment:
| Q |
28 |
tgaaacatggagcagttacacatcacttgtgaaattggagttatggaatagttgtcaaggacttactgccttctcattggatggtttccctgcgctccaa |
127 |
Q |
| |
|
|||||||||| ||| ||||||||| ||||||| ||| | ||||||||||||||| | | |||||| | ||| | |||||||||||||| || |||||| |
|
|
| T |
13163358 |
tgaaacatggggcaattacacatctcttgtgactttgcacttatggaatagttgttatgcacttacctcattccctttggatggtttcccagccctccaa |
13163457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 28 - 127
Target Start/End: Original strand, 13335282 - 13335381
Alignment:
| Q |
28 |
tgaaacatggagcagttacacatcacttgtgaaattggagttatggaatagttgtcaaggacttactgccttctcattggatggtttccctgcgctccaa |
127 |
Q |
| |
|
|||||||||| ||| ||||||||| ||||||| ||| | ||||||||||||||| | | |||||| | ||| | |||||||||||||| || |||||| |
|
|
| T |
13335282 |
tgaaacatggggcaattacacatctcttgtgactttgcacttatggaatagttgttatgcacttacctcattccctttggatggtttcccagccctccaa |
13335381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 13397831 - 13397889
Alignment:
| Q |
1 |
gtgtccgaatttaacattctccccttctgaaacatggagcagttacacatcacttgtga |
59 |
Q |
| |
|
||||| ||||||| |||||| | | ||||||||||||||| ||||||||||||||||| |
|
|
| T |
13397831 |
gtgtcagaatttagcattcttgcgtcctgaaacatggagcaattacacatcacttgtga |
13397889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 28 - 127
Target Start/End: Complemental strand, 143630 - 143531
Alignment:
| Q |
28 |
tgaaacatggagcagttacacatcacttgtgaaattggagttatggaatagttgtcaaggacttactgccttctcattggatggtttccctgcgctccaa |
127 |
Q |
| |
|
|||||||||| ||| ||||||||| ||||||| ||| | ||||||||||||||| | | |||||| | ||| | |||||||||||||| || |||||| |
|
|
| T |
143630 |
tgaaacatggggcaattacacatctcttgtgactttgcacttatggaatagttgttatgcacttacctcattccctttggatggtttcccagccctccaa |
143531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 28 - 127
Target Start/End: Complemental strand, 151935 - 151836
Alignment:
| Q |
28 |
tgaaacatggagcagttacacatcacttgtgaaattggagttatggaatagttgtcaaggacttactgccttctcattggatggtttccctgcgctccaa |
127 |
Q |
| |
|
|||||||||| ||| ||||||||| ||||||| ||| | ||||||||||||||| | | |||||| | ||| | |||||||||||||| || |||||| |
|
|
| T |
151935 |
tgaaacatggggcaattacacatctcttgtgactttgcacttatggaatagttgttatgcacttacctcattccctttggatggtttcccagccctccaa |
151836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 98 - 148
Target Start/End: Complemental strand, 17850547 - 17850497
Alignment:
| Q |
98 |
ttctcattggatggtttccctgcgctccaaagtattcacatttatggttgt |
148 |
Q |
| |
|
||||||||||||||||| ||||||||| |||| ||||||||||| ||||| |
|
|
| T |
17850547 |
ttctcattggatggttttcctgcgctcgaaagacttcacatttatagttgt |
17850497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University