View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15434_high_29 (Length: 229)
Name: NF15434_high_29
Description: NF15434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15434_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 1712936 - 1713096
Alignment:
| Q |
1 |
atgtttgtttgtttaaggatannnnnnnctgtcgtcgttgttctttaaatcataattttgttaagtattttactaattttaagaatattaactagtatag |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1712936 |
atgtttgtttgtttaaggatatttgtttctgtcgtcgttgttctttaaatcataattttgttaagtattt-actaattttaagaatattaactagtatag |
1713034 |
T |
|
| Q |
101 |
agctcgtgctggatggcacgaatgtaggagaaaaatgaggggaaccagaggtatgaattcct |
162 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1713035 |
agctcgtgctagatggcacgaaggtaggagaaaaatgaggggaaccagaggtatgaattcct |
1713096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University