View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15434_high_33 (Length: 206)
Name: NF15434_high_33
Description: NF15434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15434_high_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 7e-85; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 11 - 189
Target Start/End: Complemental strand, 35029663 - 35029485
Alignment:
| Q |
11 |
agattattcttatacttgttatgttgcttggaagactcaagagattcaacacggatgcaggtaatccatggaaacttctctgattcttgaatatcaattc |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35029663 |
agatcattcttatacttgttatgttgcttggaagactcaagaaattcaacacggatgcgggtaatccatggaaacttctctgattcttgaatatcaattc |
35029564 |
T |
 |
| Q |
111 |
tacccaacatcagctccgatttcacacaaatgtgtgatctatgatcgatttcatatcacttgtaaccaatgtacaaatt |
189 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35029563 |
tacccaacatcaactctgatttcacacaaatgtgtgatctatgatcgatttcatatcacttgtaaccaatgtacaaatt |
35029485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 11 - 96
Target Start/End: Complemental strand, 34970366 - 34970281
Alignment:
| Q |
11 |
agattattcttatacttgttatgttgcttggaagactcaagagattcaacacggatgcaggtaatccatggaaacttctctgattc |
96 |
Q |
| |
|
|||| ||||| |||||| |||||||| ||||||| || || | |||||||| ||||| ||| || ||||||||||||||||||||| |
|
|
| T |
34970366 |
agatcattctcatacttattatgttgtttggaaggcttaaaaaattcaacatggatggaggcaagccatggaaacttctctgattc |
34970281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University