View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15434_low_14 (Length: 362)
Name: NF15434_low_14
Description: NF15434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15434_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 107 - 357
Target Start/End: Original strand, 7260539 - 7260787
Alignment:
| Q |
107 |
agggttggcttggcaaaggaatgagcacggttgaaagtgctctctgtgtcaaatgattattattttatgtatgctataactgttgaaagctactattaat |
206 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7260539 |
agggttggcttggcaa-ggaatgagcacggttgaaagtgctctctgtgtcaaatgattattattttatgtatgctataactgttgaaagctactattaat |
7260637 |
T |
 |
| Q |
207 |
ttacttaaagatatagaaagtnnnnnnngcaaaatgctttataactttagttacatttttgtgtgttcctatcacctaatgaagtatcaatatctggata |
306 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7260638 |
ttacttaaagatatagaaagtaaaaaaagcaaaatgctttataactttagttatatttttgtgtgttcctatcacctaatgaagtatcaatatctggata |
7260737 |
T |
 |
| Q |
307 |
tatcacctaatgaagttttagtgtctagactagccacatccctttgctact |
357 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
7260738 |
tatcacctaatgaagttttagtgtctag-ctagccacatccctttggtact |
7260787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University