View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15434_low_23 (Length: 286)
Name: NF15434_low_23
Description: NF15434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15434_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 3 - 267
Target Start/End: Original strand, 14526890 - 14527154
Alignment:
| Q |
3 |
agacagttatgataacatgtggccatcaagtagagcataacacaagcatctttgttccgaattttgttgcgactatggagaagattagcgagcagatgcg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14526890 |
agacagttatgataacatgtggccatcaagtagagcataacacaagcatctttgttccgaattttgttgcaactatggagaagattagcgagcagatgcg |
14526989 |
T |
|
| Q |
103 |
cagtaccggcttcggcacagcagttacagggacaggacctgatgataactatggcctagcacaatgctatggagatctttcattacttgactgtgtgttg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14526990 |
cagtaccggcttcggcacagcagttacagggacaggacctgatgataactatggcctagcacaatgctatggatatctttcattacttgactgtgtgttg |
14527089 |
T |
|
| Q |
203 |
tgttatgctgaggcgcgcacggttcttcctcagtgcttcccttataactccggtcacatttacct |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14527090 |
tgttatgctgaggcgcgcacggttcttcctcagtgcttcccttataactccggtcgcatttacct |
14527154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University