View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15434_low_30 (Length: 232)
Name: NF15434_low_30
Description: NF15434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15434_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 6108630 - 6108756
Alignment:
| Q |
1 |
cccttcaacaaatactcatggatcatgacacacaattcattcagtataatggatgcaccctctttgaatggagttcaaagacttactttttataatcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6108630 |
cccttcaacaaatactcatggatcatgacacataattcattcagtataatggatgcaccctctttgaatggagttcaaagacttactttttataatcaag |
6108729 |
T |
|
| Q |
101 |
aagacactgttactaaccaattgaggg |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
6108730 |
aagacactgttactaaccaattgaggg |
6108756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 73 - 127
Target Start/End: Complemental strand, 39066537 - 39066483
Alignment:
| Q |
73 |
gttcaaagacttactttttataatcaagaagacactgttactaaccaattgaggg |
127 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| ||||| || ||||||| |
|
|
| T |
39066537 |
gttcaaagactaactttttacaatcaagaagacactgtaactaatcagttgaggg |
39066483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University